Ralstonia solanacearum str. GMI1000

  1. RS05861ISRso1RS05861 ISRso1

RS05861
RSp0126
RSp0126
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0127
RSp0127
ID ISRso1
AC RS05861
LO RS05861
OR AL646053 from 147339 to 148222 on strand -
DE ISRso1
CL
PM
AN
SQ 884 nt
 
........10........20........30........40........50
| | | | |
GAGCCCGTTTGAAAATTCCCCGCCGTTGTGGTGTAAAGGCGGGATGTGGA
AAAAAGAACATCGAGAACGCGAGGCGAAGCTGGGTCGCAAGACCAAGCGG
TACCCAAGCGACCTGACGGATATCGAATGGGTCGCTGTGCAGCCGTTGCT
GCCCCGCGCCGCCGTGCGAGGTCGGCGTCGGGAGTGCGACTTGAGGGAGG
TGGTCAACGCCTTGCGCTATCTTGTGCGAGCGGGCTGCGGTTGGCGCATG
CTGCCTCACGACTTCCCGCCTTGGCAAACCGTGTATTGGTGGTTTCGTCG
GCTCATGCGTCGCTTCCTGTTCCGCACGCTGCACGACGTGGTGCTGATGT
TGGACCGGGAGTTGGCTGGGCGGCAGCCGTGCCCAAGTGCGGGCGTCATC
GACAGCCAGACAGTCAAAGCGCCCTCGGCCGACAAGCGTGGCTACGACGC
GGCCAAGAAAATCGTCGGGCGCAAGCGGCATATCGCGGTGGACACGGATG
GACGGCTGCTGATGGTGAACCTGACACCGGCGGACATTGCTGATAGCACG
GGTGCGCTGGCGGTGCTGGAAGCGGTGAAGAAGCGCTGGCCAGGCATAAA
ACACCTGTTCGCTGACGGTGCGTATGACCGCACAGCGCTGATGGACAAGG
CATCGACCCTCGACTTCGTGGTTGAGGTGGTGCGCCGGCACGAGCAGCAA
ACGGGCTTTGCCGTTCTGCCGCGCCGCTGGGTGGTCGAGCGCACCTTTGG
ATGGATGGTTCGCTGGCGTCGACTCGTACGCGACTACGAACAGCGGGCAG
ACGTATCGGAAGCCATGATTCATATCGCGATGAGCGGCTTGCTACTGCGC
AGAATCGCTCATCCTTGAATTTCCAAACGGGCTC
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one pOoTn40B)