Ralstonia solanacearum str. GMI1000

  1. RS05820ISRso5RS05820 ISRso5

RS05820
RSp0216
RSp0216
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSp0217
RSp0217
ID ISRso5
AC RS05820
LO RS05820
OR AL646053 from 269706 to 270872 on strand +
DE ISRso5
CL
PM
AN
SQ 1167 nt
 
........10........20........30........40........50
| | | | |
CTAGTGTCCTGTTCCGTTGTTAACTGGTCTAAGTTTACATAGGATGTTGG
CATCAACGAAACGGGAGATGCCAGCATGCCAATGGGACGGCCGAAGGCGG
AACTGGTGCTGAGCGAGGACGAGCAGACGCAACTGGCTGGGATGGTGCGT
TCGCGCAGTATCCCGGCGGCGTTGGTGATGCGTGCGCGCCTTGTCTTGGC
GGCGGCCGCAGGCGAGCCCAACAGTGAGATCGCCGAGCGCCTGCAGCTCA
CGCGCGCTACGGTGGGCAAATGGCGCGCCCGGTTCCTTGAGCGGCGCATC
AATGGGTTGTACGACGAACTGCGACCCGGCAAGCCGCGTACCATCGACGA
CGAGCGCGTGGCCGAACTCATCAAGACGACGCTGCATACGAAGCCTGCGG
ATGGCTCGACTCACTGGAGTGTGCGCGCGGTGGCGGCCGAGACATCGATC
TCGCCTACCAGCGTGCACCGCTATTTCAAGCTGTTGGGGCTGCAACCGCA
TCGCAGCGAGACCTTCAAGCTGTCCACCGATGCGTTTTTCATCGAGAAGC
TGCGCGACGTGGTGGGGCTGTATCTGAACCCGCCCGAGAATGCATTGGTG
CTGTGCGTGGACGAGAAGAGCCAGTGCCAGGCACTGGAGCGCACTCAGCC
GATGCTGCCCATGGGGCTGGGCTATGTCGAAGGCGTCACCCACGACTATG
TCCGCCATGGCACAACGACGCTGTTTGCCGCGCTGAACGTACTCAACGGC
GCGGTACTGGCCGAGTGTAAGCCGCGCCATCGGCACCAAGAGTTCCTCGC
CTTCTTGCGCTCGATCGACAAAGCCGTGCCCGCCGACCTCGATGTGCATT
GCATCGTGGATAACTACAGCAGCCATAAGCATCCCAAGGTCAAGGCGTGG
CTGGCGGCCCGTCCGCGCTGGCATATGCACTTCATCCCGACCTACAGCTC
TTGGCTCAATCAGGTCGAACGCTTCTTCGCGATCATTACCGACAAGGCCA
TTCGCCGTGGCTCGTTCACGTCGGTTAAGGAACTGGTTCAGAAGATCGAT
CACTTCGTCGCTCACTACAACCAGAACTGCAAACCATTCGCTTGGACCGC
GACCGCTGATTCAATCCTCTCCAAGCTCAGCAGACTTTGCGAACGAATTA
GCGGAACGGGACACTAG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 5GmGvN2J)