Ralstonia solanacearum str. GMI1000

  1. RS05818ISRso5RS05818 ISRso5

RS05818
RSc0636
RSc0636
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc0637
RSc0637
ID ISRso5
AC RS05818
LO RS05818
OR AL646052 from 683357 to 684523 on strand +
DE ISRso5
CL
PM
AN
SQ 1167 nt
 
........10........20........30........40........50
| | | | |
CTAGTGTCCTGTTCCGTTGTTAACTGGTCTAAGTTTACATAGGATGTTGG
CATCAACGAAACGGGAGATGCCAGCATGCCAATGGGACGGCCGAAGGCGG
AACTGGTGCTGAGCGAGGACGAGCAGACGCAACTGGCTGGGATGGTGCGT
TCGCGCAGTATCCCGGCGGCGTTGGTGATGCGTGCGCGCCTTGTCTTGGC
GGCGGCCGCAGGCGAGCCCAACAGTGAGATCGCCGAGCGCCTGCAGCTCA
CGCGCGCTACGGTGGGCAAATGGCGCGCCCGGTTCCTTGAGCGGCGCATC
AATGGGTTGTACGACGAACTGCGACCCGGCAAGCCGCGTACCATCGACGA
CGAGCGCGTGGCCGAACTCATCAAGACGACGCTGCATACGAAGCCTGCGG
ATGGCTCGACTCACTGGAGTGTGCGCGCGGTGGCGGCCGAGACATCGATC
TCGCCTACCAGCGTGCACCGCTATTTCAAGCTGTTGGGGCTGCAACCGCA
TCGCAGCGAGACCTTCAAGCTGTCCACCGATGCGTTTTTCATCGAGAAGC
TGCGCGACGTGGTGGGGCTGTATCTGAACCCGCCCGAGAATGCATTGGTG
CTGTGCGTGGACGAGAAGAGCCAGTGCCAGGCACTGGAGCGCACTCAGCC
GATGCTGCCCATGGGGCTGGGCTATGTCGAAGGCGTCACCCACGACTATG
TCCGCCATGGCACAACGACGCTGTTTGCCGCGCTGAACGTACTCAACGGC
GCGGTACTGGCCGAGTGTAAGCCGCGCCATCGGCACCAAGAGTTCCTCGC
CTTCTTGCGCTCGATCGACAAAGCCGTGCCCGCCGACCTCGATGTGCATT
GCATCGTGGATAACTACAGCAGCCATAAGCATCCCAAGGTCAAGGCGTGG
CTGGCGGCCCGTCCGCGCTGGCATATGCACTTCATCCCGACCTACAGCTC
TTGGCTCAATCAGGTCGAACGCTTCTTCGCGATCATTACCGACAAGGCCA
TTCGCCGTGGCTCGTTCACGTCGGTTAAGGAACTGGTTCAGAAGATCGAT
CACTTCGTCGCTCACTACAACCAGAACTGCAAACCATTCGCTTGGACCGC
GACCGCTGATTCAATCCTCTCCAAGCTCAGCAGACTTTGCGAACGAATTA
GCGGAACGGGACACTAG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one DEDBHd5L)