Ralstonia solanacearum str. GMI1000

  1. RS05812ISRso5RS05812 ISRso5

RS05812
RSc2175
RSc2175
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2176
RSc2176
ID ISRso5
AC RS05812
LO RS05812
OR AL646052 from 2360110 to 2361276 on strand +
DE ISRso5
CL
PM
AN
SQ 1167 nt
 
........10........20........30........40........50
| | | | |
CTAGTGTCCTGTTCCGTTGTTAACTGGTCTAAGTTTACATAGGATGTTGG
CATCAACGAAACGGGAGATGCCAGCATGCCAATGGGACGGCCGAAGGCGG
AACTGGTGCTGAGCGAGGACGAGCAGACGCAACTGGCTGGGATGGTGCGT
TCGCGCAGTATCCCGGCGGCGTTGGTGATGCGTGCGCGCCTTGTCTTGGC
GGCGGCCGCAGGCGAGCCCAACAGTGAGATCGCCGAGCGCCTGCAGCTCA
CGCGCGCTACGGTGGGCAAATGGCGCGCCCGGTTCCTTGAGCGGCGCATC
AATGGGTTGTACGACGAACTGCGACCCGGCAAGCCGCGTACCATCGACGA
CGAGCGCGTGGCCGAACTCATCAAGACGACGCTGCATACGAAGCCTGCGG
ATGGCTCGACTCACTGGAGTGTGCGCGCGGTGGCGGCCGAGACATCGATC
TCGCCTACCAGCGTGCACCGCTATTTCAAGCTGTTGGGGCTGCAACCGCA
TCGCAGCGAGACCTTCAAGCTGTCCACCGATGCGTTTTTCATCGAGAAGC
TGCGCGACGTGGTGGGGCTGTATCTGAACCCGCCCGAGAATGCATTGGTG
CTGTGCGTGGACGAGAAGAGCCAGTGCCAGGCACTGGAGCGCACTCAGCC
GATGCTGCCCATGGGGCTGGGCTATGTCGAAGGCGTCACCCACGACTATG
TCCGCCATGGCACAACGACGCTGTTTGCCGCGCTGAACGTACTCAACGGC
GCGGTACTGGCCGAGTGTAAGCCGCGCCATCGGCACCAAGAGTTCCTCGC
CTTCTTGCGCTCGATCGACAAAGCCGTGCCCGCCGACCTCGATGTGCATT
GCATCGTGGATAACTACAGCAGCCATAAGCATCCCAAGGTCAAGGCGTGG
CTGGCGGCCCGTCCGCGCTGGCATATGCACTTCATCCCGACCTACAGCTC
TTGGCTCAATCAGGTCGAACGCTTCTTCGCGATCATTACCGACAAGGCCA
TTCGCCGTGGCTCGTTCACGTCGGTTAAGGAACTGGTTCAGAAGATCGAT
CACTTCGTCGCTCACTACAACCAGAACTGCAAACCATTCGCTTGGACCGC
GACCGCTGATTCAATCCTCTCCAAGCTCAGCAGACTTTGCGAACGAATTA
GCGGAACGGGACACTAG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 49iScwMY)