Ralstonia solanacearum str. GMI1000

  1. RS05810ISRso5RS05810 ISRso5

RS05810

Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc0103
RSc0103
ID ISRso5
AC RS05810
LO RS05810
OR AL646052 from 117917 to 119083 on strand +
DE ISRso5
CL
PM
AN
SQ 1167 nt
 
........10........20........30........40........50
| | | | |
CTAGTGTCCTGTTCCGTTGTTAACTGGTCTAAGTTTACATAGGATGTTGG
CATCAACGAAACGGGAGATGCCAGCATGCCAATGGGACGGCCGAAGGCGG
AACTGGTGCTGAGCGAGGACGAGCAGACGCAACTGGCTGGGATGGTGCGT
TCGCGCAGTATCCCGGCGGCGTTGGTGATGCGTGCGCGCCTTGTCTTGGC
GGCGGCCGCAGGCGAGCCCAACAGTGAGATCGCCGAGCGCCTGCAGCTCA
CGCGCGCTACGGTGGGCAAATGGCGCGCCCGGTTCCTTGAGCGGCGCATC
AATGGGTTGTACGACGAACTGCGACCCGGCAAGCCGCGTACCATCGACGA
CGAGCGCGTGGCCGAACTCATCAAGACGACGCTGCATACGAAGCCTGCGG
ATGGCTCGACTCACTGGAGTGTGCGCGCGGTGGCGGCCGAGACATCGATC
TCGCCTACCAGCGTGCACCGCTATTTCAAGCTGTTGGGGCTGCAACCGCA
TCGCAGCGAGACCTTCAAGCTGTCCACCGATGCGTTTTTCATCGAGAAGC
TGCGCGACGTGGTGGGGCTGTATCTGAACCCGCCCGAGAATGCATTGGTG
CTGTGCGTGGACGAGAAGAGCCAGTGCCAGGCACTGGAGCGCACTCAGCC
GATGCTGCCCATGGGGCTGGGCTATGTCGAAGGCGTCACCCACGACTATG
TCCGCCATGGCACAACGACGCTGTTTGCCGCGCTGAACGTACTCAACGGC
GCGGTACTGGCCGAGTGTAAGCCGCGCCATCGGCACCAAGAGTTCCTCGC
CTTCTTGCGCTCGATCGACAAAGCCGTGCCCGCCGACCTCGATGTGCATT
GCATCGTGGATAACTACAGCAGCCATAAGCATCCCAAGGTCAAGGCGTGG
CTGGCGGCCCGTCCGCGCTGGCATATGCACTTCATCCCGACCTACAGCTC
TTGGCTCAATCAGGTCGAACGCTTCTTCGCGATCATTACCGACAAGGCCA
TTCGCCGTGGCTCGTTCACGTCGGTTAAGGAACTGGTTCAGAAGATCGAT
CACTTCGTCGCTCACTACAACCAGAACTGCAAACCATTCGCTTGGACCGC
GACCGCTGATTCAATCCTCTCCAAGCTCAGCAGACTTTGCGAACGAATTA
GCGGAACGGGACACTAG
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one JP06H6UK)