Ralstonia solanacearum str. GMI1000

  1. RS05803ISRso14RS05803 ISRso14

RS05803
RSc2404
RSc2404
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc2405
RSc2405
ID ISRso14
AC RS05803
LO RS05803
OR AL646052 from 2611668 to 2612901 on strand -
DE ISRso14
CL
PM
AN
SQ 1234 nt
 
........10........20........30........40........50
| | | | |
TGACCTGCCCCCAATAAACCGGTCCACCGGGAAGCTAGTAGAGTCCGTTT
TCGGAGAGGAAGACGGACATGAAGAAGCGGTTTACGGAAGCGCAAATCAT
CGGGTTCCTGAAGGAGGCCGAGGCCGGCGTGGCGGTCAAGGAGCTGTGCA
GGAAGCACGGATTCAGTGACGCATCGTTCTACACCTGGCGGGCCAAGTTC
GGCGGGATGGAGGTGTCGGAGGCCCGGCGGCTCAAGGAGCTGGAAGCCGA
GAACGCCAAGCTGAAGAAGCTGCTGGCCGAAGCGATGCTGGACATGGAAG
CGCTGAAGGTGGTGGTCAAGGGAAAGCCCTGAGCCCGCAAGCCAAGCGCG
AGGCGGTCGTGGCGATTCGGCGGAAGGTCAGCATCTCCGAGCGTCGCGCC
TGCCGGCTTGTCGGGCTGTCCCGCAGCGTGCTGCATTACGAAGCGCAAAC
TGCGCCAGGAAACGAGATACTCAAAGCGCGGCTGGTTGAGCTGGCGCATG
AGCGTCGGCGCTTTGGTTACCGGCGACTGCACGTTCTGCTGGAGCGCGAG
GGTCTGCACGCGAATCACAAACGCGTACACCGGTTATATCGCGAGGCTGG
CTTGGCTGTGCGGCGTCGGCGGCGACGCCACGGCGTGATGGTCGAGCGCG
AGCGACTGGCTCTGCCGGCCGCGCCGAACGAGGTCTGGTCGATAGACTTC
GTGATGGACGCGTTGTCCAATGGGCGTCGCCTGAAGTGCCTGACCATCGT
TGATGACTTCACGAAAGAAGCGGTCGACATCGTCGTAGACCACGGCATCT
CAGGCTTGTATGTGGCACGAGCGCTGGACCATGCGGCGCGCTTCAGGGGC
TACCCCAAAGCGCTGCGCACGGACCAAGGGCCGGAGTTCACGAGCCGAGC
GCTGGACCAGTGGGCATACGCCAGCGGCGTGTCCCTGAAATTGATTCAGG
CTGGCAAACCGACGCAGAATGCCTACATCGAGTCGTTCAACGGCAAGTTC
CGAGACGAATGCCTGAATGAGCACTGGTTCACGAGCCTTGCCCATGCACG
CGCTGTCATCGCGGCGTGGCGCCAGGATTACAACGAGGCGCGGCCGCACA
GCGCCTTGAATTACCAACCGCCTGCAGAATTCGCAGCGCGGTATCGAGCA
ACAGCGGTGGCTCCTGCCGCTCAGGAGCAAACTTGAATTGGGCTTTACTA
GAAGCCCTCTGGCCCTGTTGCCGGGGGCAGGTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one UyaDDTD6)