Ralstonia solanacearum str. GMI1000

  1. RS05736ISRso10RS05736 ISRso10

RS05736
RSc1433
RSc1433
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1434
RSc1434
ID ISRso10
AC RS05736
LO RS05736
OR AL646052 from 1538788 to 1540123 on strand +
DE ISRso10
CL
PM
AN
SQ 1336 nt
 
........10........20........30........40........50
| | | | |
TGGAACGGCCCCCAGAATCCCCGGACACAGTCACCCACTTAAACTACGGG
TAGGCATACGACTGTGTTTATGACTAGCAGCAACCAAGAAGTGATGGAAG
TGTTGACGGGCCCGGAGCGTCGCCGGCGGTGGTCGGTGGAAGAGAAGCTT
GCGATGGTCCGAGAGAGCTTTGAGCCGGGCAAGACGGTCTCGATGGTGGC
GCGCCAGCACGGCGTGAATCCGAATCAGGTGTTCCAGTGGCGCAAGCTGT
ACCAAGACGGGAGCCTGTCGGCAGTGACCGCGGGCGAGGAAGTGGTGCCG
GCCTCGGAGCTGGCCGAAGCGCTCAAACAAGTCCGTGAGCTGCAGCGCAT
GCTCGGCAAGAAGACGATGGAGAACGAGATTCTTCGCGAAGCCGTGGAAT
ACGGTCGGGCAAAAAAGTGGATAGCGCGCTCGCCATCGTTGCCGGGGGAC
GACCAGTGAAGCTAGTTTGCGAGGTCCTCGGCGTAGCGCGCTCAAACGTG
GCGGCCAAGCGGGCCCGGCCGGGTGATTGGCGCGACGGGCGCACAGCTCG
GCAAACCGACGACGCTAGCTTGGTCGACGAAATCCGGCGCACCATCGCCG
ACTTGCCGAGCTATGGCTACCGGCGGGTCTGGGGCAGATTGCGGCGCGAA
CGTGAGCGTCAATGCGAAGCGCCGATCAATGCCAAGCGTGTCTATCGGGT
CATGCGTGTGCACAGCTTGCTGCTTGAGCGCAGGCCGACGCCACCGCGTC
CACCGCGCCGGCATGACGGCAAGGTCGCCGTGGCCAAGAGCAACCAGCGC
TGGTGCTCCGATGGCTTCGAGTTCCGCTGCGACAACGGCGAGCCGCTGCG
GGTGACGTTCGCGCTGGATTGCTGCGACCGCGAGGCGATGAGCTGGGTGG
CGACGACCGGCGGCTACAGCGGCGACGTAGTACGCGACGTGATGCTGGCG
GCCGTCGAGCAGCGCTTCGGCAATGTTCCGAAAGCGCCAGCGGAAATTGA
ATGGCTGACGGACAACGGCTCAGGCTACATTGCTGGGAAGACTCGCGAGT
TCGCCACGGACATTGGCTTGAAGCCATTGACGACACCGGTTTGCAGCCCG
CAGAGCAACGGCATGGCCGAGAGCTTCGTGAAGACGATGAAGCGCGACTA
CGTCGCCTTCATGCCCAAGCCTGACGCGGCCACAGCGACGCGCAACCTCG
CCATCGCGTTCGAGCATTACAACGAGCAGCATCCCCATAGCGCACTGAAA
TATCGCTCGCCACGCGAGTTCAGGCGCAGGACGGAATCATCAACTCAAGT
GTGAGGCGGTGTCCGGAGATGCGGGGGCAAATCCAA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one 14ZvQsSt)