Ralstonia solanacearum str. GMI1000

  1. RS04376ISRso10RS04376 ISRso10

RS04376
RSc1829
RSc1829
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc1830
RSc1830
ID ISRso10
AC RS04376
LO RS04376
OR AL646052 from 2001514 to 2002848 on strand -
DE ISRso10
CL
PM
AN
SQ 1335 nt
 
........10........20........30........40........50
| | | | |
TGGAACGGCCCCCAGAATCCCCGGACACAGTCACCCACTTAAACTACGGG
TAGGCATACGACTGTGTTTATGACTAGCAGCAACCAAGAAGTGATGGAAG
TGTTGACGGGCCCGGAGCGTCGCCGGCGGTGGTCGGTGGAAGAGAAGCTT
GCGATGGTCCGAGAGAGCTTTGAGCCGGGCAAGACGGTCTCGATGGTGGC
GCGCCAGCACGGCGTGAATCCGAATCAGGTGTTCCAGTGGCGCAAGCTGT
ACCAAGACGGGAGCCTGTCGGCAGTGACCGCGGGCGAGGAAGTGGTGCCG
GCCTCGGAGCTGGCCGAAGCGCTCAAACAAGTCCGTGAGCTGCAGCGCAT
GCTCGGCAAGAAGACGATGGAGAACGAGATTCTTCGCGAAGCCGTGGAAT
ACGGTCGGGCAAAAAAGTGGATAGCGCGCTCGCCATCGTTGCCGGGGGAC
GACCAGTGAAGCTAGTTTGCGAGGTCCTCGGCGTAGCGCGCTCAAACGTG
GCGGCCAAGCGGGCCCGGCCGGGTGATTGGCGCGACGGGCGCACAGCTCG
GCAAACCGACGACGCTAGCTTGGTCGACGAAATCCGGCGCACCATCGCCG
ACTTGCCGAGCTATGGCTACCGGCGGGTCTGGGGCAGATTGCGGCGCGAA
CGTGAGCGTCAATGCGAAGCGCCGATCAATGCCAAGCGTGTCTATCGGGT
CATGCGTGTGCACAGCTTGCTGCTTGAGCGCAGGCCGACGCCACCGCGTC
CACCGCGCCGGCATGACGGCAAGGTCGCCGTGGCCAAGAGCAACCAGCGC
TGGTGCTCCGATGGCTTCGAGTTCCGCTGCGACAACGGCGAGCCGCTGCG
GGTGACGTTCGCGCTGGATTGCTGCGACCGCGAGGCGATGAGCTGGGTGG
CGACGACCGGCGGCTACAGCGGCGACGTAGTACGCGACGTGATGCTGGCG
GCCGTCGAGCAGCGCTTCGGCAATGTTCCGAAAGCGCCAGCGGAAATTGA
ATGGCTGACGGACAACGGCTCAGGCTACATTGCTGGGAAGACTCGCGAGT
TCGCCACGGACATTGGCTTGAAGCCATTGACGACACCGGTTTGCAGCCCG
CAGAGCAACGGCATGGCCGAGAGCTTCGTGAAGACGATGAAGCGCGACTA
CGTCGCCTTCATGCCCAAGCCTGACGCGGCCACAGCGACGCGCAACCTCG
CCATCGCGTTCGAGCATTACAACGAGCAGCATCCCCATAGCGCACTGAAA
TATCGCTCGCCACGCGAGTTCAGGCGCAGGACGGAATCATCAACTCAAGT
GTGAGGCGGTGTCCGGAGATGCGGGGGCAAATCCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one lUoP8BnN)