Ralstonia solanacearum str. GMI1000

  1. RS00582ISRso11RS00582 ISRso11

RS00582
RSc3088
RSc3088
Cluster
DrawMap
XML file

FASTA file
Extract
Sequence
RSc3089
RSc3089
ID ISRso11
AC RS00582
LO RS00582
OR AL646052 from 3326411 to 3327859 on strand -
DE ISRso11
CL
PM
AN
SQ 1449 nt
 
........10........20........30........40........50
| | | | |
TGAACTGCACCCCAAAAGTTGGACATCTGTTCAACCTTTGGGGTGTTTTT
CATGGCGAAGTATGAAGAGGCGTTCAAGCGCCAAGTAGTTCAGGAGTATT
TGAGGGGGGCCGTTGGGACCGCAGGGCTGAGCCAGAAGTACGGGATAGGC
CGTTCTGTGATCCGGCGCTGGATCAACGCGTGGCAGCGCCATGGGAAATC
CGGACTACGCAAGAAGCATGAAGCGTATAGCGCCGAGTTCAAGCTGACGG
TGCTGCAGCGCATGTGGCGCGACGAGTTGTCCTATCAGCAAGTCAGCGCT
GTGTTCGATTTGCGTGAGGCTGGCGGCGTCAGCCGCTGGGACCGCCAGTA
TCATGAGGGCGGTTTCGACGCCCTACAGCCGCGCCGCAAAGGCGGGGCAC
CCATCATGTCCCAGTCCAAGCAAGATCCCCAACCCGCTGCGCAGCCGGCT
CAAGACGAGCGCTCGCGCGAGGATTTGCTCAAAGAGAACGAGTGTTTGCG
CGCGGAGGTGGCGTACCTAAAAAAGTTAGATGCCCTGCTGCGTGCCAAAC
AGCAGCAGGCACCAAAGAAAAAGCGCAAGTCGTGAGTGCGCTGCGTGAGC
GGCATTCATTGTCGAGCTTGCTCAAGGCCGCGAATCTCGCACGCAGCACG
TACTACTACCAGATGGCGACAGGCCAGGCAGAGGATCGTCACGGCGCGCT
CAAGGAGCGCATTCAGCACATCTATGCCCAGCACAAGGGCCGATATGGCT
ACCGCCGGATCACGGCGACGCTCCGTCGGGCAGGGACGTTGGTGAATCAC
AAGACCGTACAGCGATTGATGTCGGCGCTACAGTTGAAGTCACTCGTGCG
GCCGAAGAAATACCGCTCTTACCTCGGGCAAGTCGGGCGGGTTGCTCCCA
ATCTGCTACAGCGCGAGTTTGAGGCGAGCAAGCCGAACGAGAAGTGGGTA
ACGGACGTGACGGAGTTCAACGTCGGCGGCAAAAAGCTGTACCTGTCGCC
CGTCCTGGACCTATACAACGGAGAGATCGTCGCCTGGCAAACCAGTGAAC
GACCTGATTACACGCTGATCCGGGAGATGCTCGACAAGGCGTTGCGCAAG
CTGCGCCCGTGCGAGACGCCGATGCTGCATTCGGATCAAGGCTGGCCGTA
TCAAATGGCAGCGTATCGTCGCAAACTGGCCGCGCGAGGCCTGCGCCAGA
GCATGTCCCGCAAAGGCAACTGCCTAGACAATGCGGCAATGGAAAGCTTC
TTCGGCACACTCAAGTCAGAGTGCTTCCGGTTAGAGCGCTTCGCGGACAT
CGACCAACTGCGACGCGCCATTGCCGAATACATCCGGTACTACAATCACG
AGCGCATCAAGATCAAGCTAAAAGGGCTGAGCCCTGTGCAATACAGGACC
CAGCCCTTGGCCGCCTAAATTACCCGTCCAACTTTACGGGGTCAGTTCA
Show or not Suggestions

Suggest an annotation

Move your mouse over each field to get more informations

ID
DE
EC
GO
PM
CC
CL
  Your email
  Validation code (copy this one AErEqyBA)